London 2012

Pathologies of Our Peculiar Age

August 02, 2012

Multiple Pages
Pathologies of Our Peculiar Age

The USA, I’m sorry to see, is currently behind China in gold medals, 17-12.

And oh dear, there’s Britain, with only two gold medals.

It’s only Wednesday night, though—end of the fifth day, eleven still to go. I’m sure the old country will perk up and gather a few more golds. It can’t possibly be the case, as that dire opening ceremony seemed to suggest, that the entire national genius of the British is now concentrated on running hospitals, recycling old pop songs, writing whimsical stories for children, performing the national anthem in sign language, and celebrating diversity.

Or as Peter Hitchens said in a wonderfully peppery Daily Mail column:

It is a strange sort of nation that can turn a hospital bed into a symbol of national pride, especially in an era when you can die of thirst in one.

Yes, I’m trying to keep up with the Olympics. This goes against my general inclinations.

“The Olympics are still one place where nations compare themselves with each other.”

For one thing, there’s the totalitarian angle. A huge organized sporting event like this, with its son et lumière opening spectacle, hundreds of flags paraded around to the cheers of the multitude, and strong social pressure on us all to show enthusiastic approval, inevitably brings to mind the great 20th-century despotic utopias. Does the name Leni Riefenstahl mean anything?

As I blogged three Olympics ago (how time flies!):

The reason that fascists and communists love sport is, of course, that sport has no linguistic content. Totalitarians hate language and wage constant war against it — another thing Orwell taught us. Sport is therefore the ideal lowbrow entertainment from the point of view of jealous power elites, just as ballet is the ideal highbrow entertainment. The old Soviet Union poured huge resources into both.

The main venue for this year’s Olympics is in London’s East End, not far from the hyper-gentrified Isle of Dogs, where my wife and I owned a pleasant little apartment twenty-something years ago. We bought at the top of the market and sold at the bottom, for £100,000 each time. Now the damn thing is worth half a million at least. This rankles. I’d rather not be reminded.

(Should I ever offer you advice about real-estate investment, run like the wind!)

The Games are like a great lens, magnifying all the pathologies of our peculiar age. The opening ceremony was one long, monstrous illustration of this truth, pathology after pathology paraded before us as if old London was a beggar displaying his sores: stagnant popular culture, progressivism’s bogus iconography, rampant “diversity,” and a kind of valetudinarian supremacy forcing our attention toward the sick and disabled even at a festival of health and strength.

Poor Muhammad Ali, who though only one of the nine bearers of the Olympic flag—and perforce a token one at that, given his sad condition—was in a way the perfect emblem of what the opening ceremony was striving for: Black! Muslim! Pacifist! Disabled!

So no, I’m not much of an Olympics fan. And yet I watch and check the medal tables.

For all the globalist twaddle, for all the PC triumphalism, for all the gross waste of public funds, for all the North Korean-style massed choirs and dance troupes (which must have been an inspiration to the actual Norks: they have four gold medals, which is more than Germany, Great Britain, and Russia have)—for all that, the Olympics are still one place where nations compare themselves with each other.

Diversify us all you like. Shower us with multicultural imagery. Open our borders to all the world’s wanderers. Teach our children to hate their ancestors and despise their own race. Make us press “2” for our own language. Still, nine out of ten people watching the Olympics, even in the terminally decadent West, are rooting for their nation (though not necessarily for the nation of their current domicile).

Well, well, no doubt we shall soon be One World, blending together in multicultural harmony. Then the true Olympic spirit will prevail: not nation against nation, only athlete against athlete.

By that time, though, as Randall Parker has speculated, the Olympic Games may be redundant:

Since super athletes have genes that make them far more able to compete some argue that sporting competitions are just elaborate games aimed at identifying who has the best genetic sequences. Great sporting competitions, whether professional or amateur, end up turning into elaborate mechanisms for filtering for the most genetically well endowed. Falling genetic sequencing costs promise to take away the need for sporting competitions for this purpose.

Then we shall be able to dispense with the events and the spectacle altogether, awarding the men’s 200-meter butterfly gold to whomever has nucleotide sequence CCTAAACTCAGTGTGGCCCTGGCCCTGTGACATGCTGGCGATGCAGTCCC at the proper locus on chromosome 12.

Hey, it’ll be cheaper.

 

SUBSCRIBE
For Email Updates


Comments